View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1098_high_16 (Length: 418)
Name: NF1098_high_16
Description: NF1098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1098_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 2e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 134 - 376
Target Start/End: Complemental strand, 53635958 - 53635715
Alignment:
| Q |
134 |
tcttggatacactctttaagaattttaatgattaatttttatnnnnnnnnnta-ttatgtatttaatgcaatagaaattggaatacttaacttttttaag |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53635958 |
tcttggatacactctttaagaattttaatgattaatttttataaaaaaaaaaaattatgtatttaatgcaatagaaattggaatacttaacttttttaag |
53635859 |
T |
|
| Q |
233 |
gagtaattaattgattttggattcttaaaatatctcaaagacattcattaacnnnnnnnnttaaaatactcctgctgtttcacaaaaacggtcatattaa |
332 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53635858 |
gagtaattaattgattttggattcttaaagtatctcaaagacatttattaacaaaaaaatttaaaatactcctgctgtttcacaaaaacggtcatattaa |
53635759 |
T |
|
| Q |
333 |
taagagaatgtcgagattgtttcggtatagctttgtgtatgaag |
376 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53635758 |
taagagattgtcgagattgtttcggtatagctttgtgtatgaag |
53635715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 6 - 78
Target Start/End: Complemental strand, 53636047 - 53635975
Alignment:
| Q |
6 |
atattgtacctaccaaaggactacgtgctgatatttatttggtgtcgtttctttatttgtggcaatgcactta |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53636047 |
atattgtacctaccaaaggactacgtgctgatatttatttggtgtcgtttctttatttgtggcaatgcactta |
53635975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University