View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1098_high_30 (Length: 283)
Name: NF1098_high_30
Description: NF1098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1098_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 63 - 237
Target Start/End: Original strand, 26456436 - 26456610
Alignment:
| Q |
63 |
ccatgtttgaatagtattgttaggaagagctagtaatcaannnnnnnnatcttcctactaaaggaagaagaaatattcttagcctcttctaatcttgagt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26456436 |
ccatgtttgaatagtattgttaggaagagctagtaatcaattttttttatcttcctactaaaggaagaagaaatattcttagcctcttctaatcttgagt |
26456535 |
T |
 |
| Q |
163 |
gatgccattggggcaggagtaacatcaagtcccattatgtattggcattgatagtgtcacgtgtagtatttgtct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26456536 |
gatgccattggggcaggagtaacatcaagtcccattatgtattggcattgatagtgtcacgtgtagtatttgtct |
26456610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University