View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1098_high_35 (Length: 251)
Name: NF1098_high_35
Description: NF1098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1098_high_35 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 58 - 251
Target Start/End: Original strand, 6188799 - 6188992
Alignment:
| Q |
58 |
cttcaaactttgtccaggttagtgtcagtgcaaaattgtatgacttcattcatcacctgtggctcaacgaggcacctgttggggagctgcagtaaccagt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6188799 |
cttcaaactttgtccaggttagtgtcagtgcaaaattgtatgacttcattcatcacctgtggctcaacgaggcacctgttggggagctgcagtaactagt |
6188898 |
T |
|
| Q |
158 |
gaattgaaatggcattgctctttgtgatttgggctaaaagaattacaatagaatttcgtacagtcggagtatatacacattggagtaatcatta |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6188899 |
gaattgaaatggcattgctctttgtgatttgggctaaaagaattacaatagaatttcgtacagtcggagtatatacacattggagtaatcatta |
6188992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 72 - 152
Target Start/End: Complemental strand, 39024653 - 39024573
Alignment:
| Q |
72 |
caggttagtgtcagtgcaaaattgtatgacttcattcatcacctgtggctcaacgaggcacctgttggggagctgcagtaa |
152 |
Q |
| |
|
||||||||||| ||||||||||| ||||| ||||||||| | |||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
39024653 |
caggttagtgtgagtgcaaaattatatgagttcattcatttcttgtggctcaatgaggcaccagttggggagctgcagtaa |
39024573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University