View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1098_low_30 (Length: 322)
Name: NF1098_low_30
Description: NF1098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1098_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 82 - 277
Target Start/End: Complemental strand, 27326232 - 27326037
Alignment:
| Q |
82 |
gctgttgctgtgaattaacaagaaggaaggatcgatcttgcttactaactacaaaactgtgcatagcaaatattaatcttatggaaatcagtagagctac |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27326232 |
gctgttgctgtgaattaacaagaaggaaggatcgatcttgcttactaactacaaaactgtgcatagcaaacattaatcttatggaaatcagtagagctac |
27326133 |
T |
 |
| Q |
182 |
agctctcacttggtctcacaccgtctctccttctcttcacctacctcagcccctcctctttgtaagtttcaattttcattttctcggtgttgcgtt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27326132 |
agctctcacttggtctcacaccgtctctccttctcttcacctacctcagcccctcctctttgtaagtttcaattttcattttctcggtgttgcgtt |
27326037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University