View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1098_low_32 (Length: 318)
Name: NF1098_low_32
Description: NF1098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1098_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 69 - 175
Target Start/End: Original strand, 11399814 - 11399920
Alignment:
| Q |
69 |
taattctccagaccaaaacagaaattttcaaaggaattatagggttccaaannnnnnnatgcgccagtgttaccaatttctaaagaggaagttctagtca |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11399814 |
taattctccagaccaaaacagaaattttcaaaggaattatagggttccaaatttttttatgcgccagtgttaccaatttctaaagaggaagttctagtca |
11399913 |
T |
|
| Q |
169 |
atttttt |
175 |
Q |
| |
|
||||||| |
|
|
| T |
11399914 |
atttttt |
11399920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University