View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1098_low_42 (Length: 260)
Name: NF1098_low_42
Description: NF1098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1098_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 25 - 222
Target Start/End: Complemental strand, 43895341 - 43895143
Alignment:
| Q |
25 |
ttgccttatactttgggacatatatgagtacactagg-agaaacttcaccctggttgcagagaaagttgtgaagaaagtgtgtcagtactatgtttgtag |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
43895341 |
ttgccttatactttgggacatatatgagtacactagggagaaacttcaccctggttgcagagaaagttgtgaagaaagtgtgtgagtgctatgtttgtag |
43895242 |
T |
 |
| Q |
124 |
caggggatagcaagttggcttttcaactaccctacagatgttataaagacaagattacaagctcaaacatcttcttcattgaaatacaaaggcatcttg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43895241 |
caggggatagcaagttggcttttcaactaccctacagatgttataaagacaagattacaagctcaaacatcttcttcattgaaatacaaaggcatcttg |
43895143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 25 - 222
Target Start/End: Complemental strand, 43892253 - 43892048
Alignment:
| Q |
25 |
ttgccttatactttgggacatatatgagtacactag-gagaaacttcaccctggttgcagagaaagttgtgaagaaagtgtgtcagtactatgtttgtag |
123 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||| || ||||||||||| |||||||| |||||||||||| ||||||||||| |||||||||||| ||| |
|
|
| T |
43892253 |
ttgccttatattttggaacatat--gagtacacaagagagaaacttcatcctggttgtagagaaagttgtcaagaaagtgtg--agtactatgtttatag |
43892158 |
T |
 |
| Q |
124 |
cagggg-----------atagcaagttggcttttcaactaccctacagatgttataaagacaagattacaagctcaaacatcttcttcattgaaatacaa |
212 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43892157 |
cagggggattggcagggatagctagttggcttttcaactaccctacagatgttataaagacaagattacaagctcaaacatcttcttcattgaaatacaa |
43892058 |
T |
 |
| Q |
213 |
aggcatcttg |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
43892057 |
aggcatcttg |
43892048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University