View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1098_low_44 (Length: 251)
Name: NF1098_low_44
Description: NF1098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1098_low_44 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 7 - 251
Target Start/End: Complemental strand, 9417994 - 9417737
Alignment:
| Q |
7 |
tcgaagaatatgcatgggtttggtt-cattggcttaatttactattgtaatttctttgcttgtgagacgcgtcttcacatgcaaatttagtggcaagtaa |
105 |
Q |
| |
|
|||||| | |||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9417994 |
tcgaaggaaatgcatgggtttggtttcattggcttaatttactattgt---ttctttgcttgtgagacgcgtcttcacatgcaaatttagtgccaagtaa |
9417898 |
T |
 |
| Q |
106 |
agtacaagtttattgttgactgactcaaatggagcagccacaatt---------------aattattacactcatgtccacattctcaaagttgactccg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9417897 |
agtacaagtttattgttgactgactcaaatggagcacccacaattatttataattaagtaaattattacactcatgtccacattctcaaagttgactccg |
9417798 |
T |
 |
| Q |
191 |
accaacgtgtatatcctcgtgggaagtgaaacccatcctcttgagggtggtaaatattttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9417797 |
accaacgtgtatatcctcgtgggaagtggaacccatcctcttgagggtggtaaatattttt |
9417737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University