View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1098_low_45 (Length: 251)

Name: NF1098_low_45
Description: NF1098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1098_low_45
NF1098_low_45
[»] chr5 (1 HSPs)
chr5 (58-251)||(6188799-6188992)
[»] chr4 (1 HSPs)
chr4 (72-152)||(39024573-39024653)


Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 58 - 251
Target Start/End: Original strand, 6188799 - 6188992
Alignment:
58 cttcaaactttgtccaggttagtgtcagtgcaaaattgtatgacttcattcatcacctgtggctcaacgaggcacctgttggggagctgcagtaaccagt 157  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
6188799 cttcaaactttgtccaggttagtgtcagtgcaaaattgtatgacttcattcatcacctgtggctcaacgaggcacctgttggggagctgcagtaactagt 6188898  T
158 gaattgaaatggcattgctctttgtgatttgggctaaaagaattacaatagaatttcgtacagtcggagtatatacacattggagtaatcatta 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6188899 gaattgaaatggcattgctctttgtgatttgggctaaaagaattacaatagaatttcgtacagtcggagtatatacacattggagtaatcatta 6188992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 72 - 152
Target Start/End: Complemental strand, 39024653 - 39024573
Alignment:
72 caggttagtgtcagtgcaaaattgtatgacttcattcatcacctgtggctcaacgaggcacctgttggggagctgcagtaa 152  Q
    ||||||||||| ||||||||||| ||||| |||||||||  | |||||||||| |||||||| ||||||||||||||||||    
39024653 caggttagtgtgagtgcaaaattatatgagttcattcatttcttgtggctcaatgaggcaccagttggggagctgcagtaa 39024573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University