View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1098_low_49 (Length: 246)
Name: NF1098_low_49
Description: NF1098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1098_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 49060707 - 49060939
Alignment:
| Q |
1 |
cttcttctgagctgatgggtcctcattgtcattaccattctctttatcctcgtcttcctcttcatcctgatcctttcttttcttagtcagctttccattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49060707 |
cttcttctgagctgatgggtcctcattgtcattaccattctctttatcctcgtcttcgtcttcatcctgatcctttcttttcttagtcagctttccattt |
49060806 |
T |
|
| Q |
101 |
tcatctgaattttctgctcctgcagatcttagtccactgccactgtcagaagtagttttgtctggtttactggttttgtttttctcctttggatcagact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49060807 |
tcatctgaattttctgctcctgcagatcttagtccactgccactgtcagaagtagttttgtctggtttactggttttgtttttctcctttggatcagact |
49060906 |
T |
|
| Q |
201 |
tcttcttcctaattacatgctgccaaatgttct |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49060907 |
tcttcttcctaattacatgctgccaaatgttct |
49060939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 47274418 - 47274489
Alignment:
| Q |
1 |
cttcttctgagctgatgggtcctcattgtcattaccattctctttatcctcgtcttcctcttcatcctgatc |
72 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
47274418 |
cttcttctgagctcatgggtcctcattgtcatgaccattctctttatcctcatctttgtcttcatcctgatc |
47274489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University