View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1098_low_50 (Length: 235)
Name: NF1098_low_50
Description: NF1098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1098_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 4 - 139
Target Start/End: Original strand, 24005444 - 24005578
Alignment:
| Q |
4 |
aggaacatcattctgattgaaataaaatatactcactcctagattaatttctacttgacattagagcccttgattttgggggcatggctttcgcataaac |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24005444 |
aggaacatcattctcattgaaataaaatatactcactcatagattaatttctacttgacattagagcc-ttgattttgggggcatggctttcgcataaac |
24005542 |
T |
 |
| Q |
104 |
cctagcctccatcattatggttgttttagtttttct |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
24005543 |
cctagcctccatcattatggttgttttagtttttct |
24005578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 123
Target Start/End: Original strand, 3044185 - 3044265
Alignment:
| Q |
43 |
tagattaatttctacttgacattagagcccttgattttgggggcatggctttcgcataaaccctagcctccatcattatgg |
123 |
Q |
| |
|
|||| |||||||||| || ||| |||||||| |||||||| ||| | |||| ||||||||| |||||||||||| ||||| |
|
|
| T |
3044185 |
tagagtaatttctacatggcatcagagccctcgattttggtggccttgcttcggcataaaccttagcctccatcactatgg |
3044265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 117
Target Start/End: Complemental strand, 25124390 - 25124321
Alignment:
| Q |
48 |
taatttctacttgacattagagcccttgattttgggggcatggctttcgcataaaccctagcctccatca |
117 |
Q |
| |
|
||||||| || || ||| |||||||| |||||||||||| | |||| ||||||||| |||||||||||| |
|
|
| T |
25124390 |
taatttcaacatggcatcagagccctcgattttgggggccttgcttcggcataaaccttagcctccatca |
25124321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University