View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1098_low_51 (Length: 233)
Name: NF1098_low_51
Description: NF1098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1098_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 26375242 - 26375037
Alignment:
| Q |
1 |
gttaccaccaacattcccaatctttttatcttgcttcaaaattcatgttgtaaagttaaatcattggtgccaactatcaagtgaagaaaggacattttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26375242 |
gttaccaccaacattcccaatctttttatcttgcttcaaaattcatgttgtaaagttaaatcattggtgccaactatcaagtgaagaaaggacattttgt |
26375143 |
T |
 |
| Q |
101 |
aatcatgaacatataatgatgattaaactttcatatgttaaaaatatttgctctgttg-acgtctaaacacatcaaaacaagcagataaactataatgta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26375142 |
aatcatgaacatataatgatgattaaactttcatatgttaaaaatatttgctctgttgaacgtctaagcacatcaaaacaagcagataaactataatgta |
26375043 |
T |
 |
| Q |
200 |
tccgat |
205 |
Q |
| |
|
|||||| |
|
|
| T |
26375042 |
tccgat |
26375037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University