View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1098_low_52 (Length: 233)
Name: NF1098_low_52
Description: NF1098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1098_low_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 26375218 - 26375439
Alignment:
| Q |
1 |
aaagattgggaatgttggtggtaacaaaaacaaaattcacaattataacttgtaaatgtggtttcnnnnnnnnnnnnnnnnnnnactccagtcactgctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26375218 |
aaagattgggaatgttggtggtaacaaaaacaaaattcacaattataacttgtaaatgtggttttgtgtgtgtgtgtgtgtgtgactccagtcactgctc |
26375317 |
T |
 |
| Q |
101 |
taatcctttgctgacccccatatttattgttgcaggagaaaagaaagtggtttaagaaaatggttagtttttatttctttacctctattaaggaatcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26375318 |
taatcctttgctgacccccatatttattgttgcaggagaaaagaaagtggtttaagaaaatggttagtttttatttctttacctctattaaggattcttt |
26375417 |
T |
 |
| Q |
201 |
gttcaggttttgagcaacagct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26375418 |
gttcaggttttgagcaacagct |
26375439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University