View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1098_low_56 (Length: 222)
Name: NF1098_low_56
Description: NF1098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1098_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 4094193 - 4094318
Alignment:
| Q |
1 |
taagatattttgtgtgattttgtctaaaaattgcaaggttaagaagagttaagacaactcttgcatgtgtacatcaactaggttccacttttagtttcca |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4094193 |
taagatattttgtgtgactttgtctaaaaattgcaaggttaagaagagttaagacaactcttgcatgtgtacatcaactaggttccacttttagtttcca |
4094292 |
T |
|
| Q |
101 |
tcagagtaatatacagtcacaaatta |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4094293 |
tcagagtaatatacagtcacaaatta |
4094318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University