View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1098_low_60 (Length: 213)
Name: NF1098_low_60
Description: NF1098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1098_low_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 41043273 - 41043388
Alignment:
| Q |
1 |
agttcttgttttgttcttgctgagctttctccttctcaatttgaccataagcataccttaaaatttggctatgagtgtttaannnnnnnccctttggcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41043273 |
agttcttgttttgttcttgctgagctttctccttctcaatttgaccataagcataccttaaaatttggctatgagtgtttaatttttttccctttggcat |
41043372 |
T |
|
| Q |
101 |
ttgctttttaatgttc |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41043373 |
ttgctttttaatgttc |
41043388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 28087150 - 28087039
Alignment:
| Q |
1 |
agttcttgttttgttcttgctgagctttctccttctcaatttgaccataagcataccttaaaatttggctatgagtgtttaannnnnnnccctttggcat |
100 |
Q |
| |
|
|||| ||||||| ||||| |||||||||||||||||||| |||||||||||||| ||||||||||| || || || | ||| ||||||||||| |
|
|
| T |
28087150 |
agttattgtttttctcttgttgagctttctccttctcaatctgaccataagcatatcttaaaatttgactttgcgtatgtaaattttttccctttggcat |
28087051 |
T |
|
| Q |
101 |
ttgctttttaat |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28087050 |
ttgctttttaat |
28087039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University