View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10990_low_5 (Length: 253)

Name: NF10990_low_5
Description: NF10990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10990_low_5
NF10990_low_5
[»] chr8 (1 HSPs)
chr8 (9-183)||(39725619-39725793)
[»] chr4 (1 HSPs)
chr4 (10-179)||(5624512-5624681)
[»] chr1 (1 HSPs)
chr1 (61-161)||(13348675-13348775)


Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 9 - 183
Target Start/End: Original strand, 39725619 - 39725793
Alignment:
9 agcagcacagatgtttgtgttgagaacagccatggatgaatcaatgttggcagagtagggatctccaccgttgaaacctgcccatcccatccatagtaac 108  Q
    ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39725619 agcagcacaaatgtttgtgttgagaacagccattgatgaatcaatgttggcagagtagggatctccaccgttgaaacctgcccatcccatccatagtaac 39725718  T
109 cctgcccctgccaacgttagtaacacattgtttggtgggaatctctccctgtccttcttcgatcttggccccacc 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
39725719 cctgcccctgccaacgttagtaacacattgtttggtgggaatctctccctgtccttcttcgatctaggccccacc 39725793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 10 - 179
Target Start/End: Original strand, 5624512 - 5624681
Alignment:
10 gcagcacagatgtttgtgttgagaacagccatggatgaatcaatgttggcagagtagggatctccaccgttgaaacctgcccatcccatccatagtaacc 109  Q
    |||||||| ||||| |||||||| ||||| || || || |||||||| || |  || ||  ||||||| ||||| |||| ||| ||||||||||  || |    
5624512 gcagcacatatgttagtgttgagtacagcaatagaagagtcaatgtttgctgcatatggtgctccaccattgaaccctgaccaacccatccataacaatc 5624611  T
110 ctgcccctgccaacgttagtaacacattgtttggtgggaatctctccctgtccttcttcgatcttggccc 179  Q
    |||| ||||| | | | || || |||||||||||||||||||||||||| ||  ||||| | ||||||||    
5624612 ctgctcctgctagcataagcaatacattgtttggtgggaatctctccctatcactcttcaaccttggccc 5624681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 161
Target Start/End: Original strand, 13348675 - 13348775
Alignment:
61 gagtagggatctccaccgttgaaacctgcccatcccatccatagtaaccctgcccctgccaacgttagtaacacattgtttggtgggaatctctccctgt 160  Q
    ||||| |||||||| || ||||| |||| |||||||||||||| ||  ||||| ||||| ||| | || |  | ||||||||||||||| || |||||||    
13348675 gagtaaggatctcctccattgaatcctgtccatcccatccataatagtcctgctcctgctaacataagaaggagattgtttggtgggaacctttccctgt 13348774  T
161 c 161  Q
    |    
13348775 c 13348775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University