View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10990_low_7 (Length: 236)
Name: NF10990_low_7
Description: NF10990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10990_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 135 - 220
Target Start/End: Original strand, 39725949 - 39726034
Alignment:
| Q |
135 |
tgtagacaaaagaatatcgtccgaagattctttgaattgccgttacactaaatcatttatctcatcttctaaatttttactatgct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39725949 |
tgtagacaaaagaatatcgtccgaagattctttgtattgccgttacactaaataatttatctcatcttctaaatttttactatgct |
39726034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 5 - 62
Target Start/End: Original strand, 39725853 - 39725910
Alignment:
| Q |
5 |
tgtcaaaatataattacattatattgcaaacactaccaaacaatacatttctttcata |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39725853 |
tgtcaaaatataattacattatattgcaaacactaccaaacaatacatttctttcata |
39725910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University