View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10990_low_7 (Length: 236)

Name: NF10990_low_7
Description: NF10990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10990_low_7
NF10990_low_7
[»] chr8 (2 HSPs)
chr8 (135-220)||(39725949-39726034)
chr8 (5-62)||(39725853-39725910)


Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 135 - 220
Target Start/End: Original strand, 39725949 - 39726034
Alignment:
135 tgtagacaaaagaatatcgtccgaagattctttgaattgccgttacactaaatcatttatctcatcttctaaatttttactatgct 220  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||    
39725949 tgtagacaaaagaatatcgtccgaagattctttgtattgccgttacactaaataatttatctcatcttctaaatttttactatgct 39726034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 5 - 62
Target Start/End: Original strand, 39725853 - 39725910
Alignment:
5 tgtcaaaatataattacattatattgcaaacactaccaaacaatacatttctttcata 62  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39725853 tgtcaaaatataattacattatattgcaaacactaccaaacaatacatttctttcata 39725910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University