View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10992_high_25 (Length: 270)
Name: NF10992_high_25
Description: NF10992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10992_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 1294700 - 1294463
Alignment:
| Q |
1 |
attgatgtggaatctattgtggaggatattaaggtgtcatggaggtggtgtttgactagactagaaattctgacttgcttgtatcatgaatggagttgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1294700 |
attgatgtggaatctattgtggaggatattaaggtgtcatggaggtggtgtttgactagactagaaattctgacttgcttgtatcatgaatggagttgga |
1294601 |
T |
|
| Q |
101 |
atccgaatgagtgcctgttgaggcaacattttgtgtgagagttcagctctgttgagggtggccccatcttgtttcgatccttaacaataggtgttgtggc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1294600 |
atccgaatgagtgcctgttgaggcaacattttgcgtgagagttaagctctgttgagggtggctttatcttgtttcgatccttaacaataggtgttgtggc |
1294501 |
T |
|
| Q |
201 |
tgtggtagttgctgggattttttgtctcgggtgtgggg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1294500 |
tgtggtagttgctgggattttttgtctcgggtgtgggg |
1294463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 4 - 122
Target Start/End: Complemental strand, 53112040 - 53111919
Alignment:
| Q |
4 |
gatgtggaatctattgtggaggatattaaggtg---tcatggaggtggtgtttgactagactagaaattctgacttgcttgtatcatgaatggagttgga |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||| || ||| ||||||| |||| | ||||| ||||| ||||||| |||| | ||||||||||||| |
|
|
| T |
53112040 |
gatgtggactctattgtggaggatattaaagtgctatcgtggcggtggtgcttgaatggactaaaaattatgacttgtctgtactacgaatggagttgga |
53111941 |
T |
|
| Q |
101 |
atccgaatgagtgcctgttgag |
122 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
53111940 |
atccgaatgattgcctgttgag |
53111919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University