View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10992_high_30 (Length: 248)
Name: NF10992_high_30
Description: NF10992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10992_high_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 204
Target Start/End: Original strand, 32929092 - 32929277
Alignment:
| Q |
19 |
attgctgtttgatttgacacaaactagcagcaacatgtttttctctattttgctctgactgttataagttcattttgaggaaactttgtttattttactg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32929092 |
attgctgtttgatttgacacaaactagcagcaacatgtttttctctattttgctttgactgttataagttcattttgaggaaactttgtttattttactg |
32929191 |
T |
|
| Q |
119 |
attttctaattgtgttggtgctttgcttttatttagctaggatgcatgggactttggtctgttttcttacatcttgtgctttaaga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32929192 |
attttctaattgtgttggtgctttgcttttatttagctaggatgcatgggactttggtctgttttgttacatcttgtgctttaaga |
32929277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University