View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10992_low_28 (Length: 258)
Name: NF10992_low_28
Description: NF10992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10992_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 253
Target Start/End: Complemental strand, 14748607 - 14748373
Alignment:
| Q |
19 |
gtcttgtcttctgatactctccaccaacccatcatgcctaaattgtactacaaatttggtatgaagaatttagatcccttgaaatattttatgggtatat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14748607 |
gtcttgtcttctgatactctccaccaacccatcatgcctaaattgtattccaaatttggtatgaagaatttagatcccttgaaatattttatgggtatat |
14748508 |
T |
 |
| Q |
119 |
ctattacacgacattaataaggtcttattattttactaaaagaaatatttcgaagaaatcaatgagcaagaacatatgtcttcttgcaaacaatcttcta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14748507 |
ctattacacgacattaataaggtcttattattttactaaaagaaatatttcgaagaaatcaatgagcaagaacatatgtcttcttgcaaaccatcttcta |
14748408 |
T |
 |
| Q |
219 |
cagcggttgacacacaagttaaactctgtgctgct |
253 |
Q |
| |
|
|| ||||||||||||||||||||||| ||| |||| |
|
|
| T |
14748407 |
caccggttgacacacaagttaaactcagtggtgct |
14748373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University