View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10992_low_34 (Length: 228)
Name: NF10992_low_34
Description: NF10992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10992_low_34 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 20 - 228
Target Start/End: Complemental strand, 32929697 - 32929489
Alignment:
| Q |
20 |
ttgaacagaataaaaaataatataaagtggcattcttaatcatttannnnnnncaaactaacgcagaccgttatattttcatatcatatatcaaatgtat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32929697 |
ttgaacagaataaaaaataatataaagtggcattcttaatcatttatttttttcaaactaacgcagaccgttatattttcatatcatatatcaaatgtat |
32929598 |
T |
|
| Q |
120 |
tccgcattttgctagaagttattcttcatagtattagacattttttagtcaaatagttgtttgataatatgtttatgtctctttcgacttaatcaaaagt |
219 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32929597 |
tccgcactttgttagaagttattcttcatagtatttgacattttttagtcaaatagttgtttgataatatgtttatgtctctttcggcttaatcaaaagt |
32929498 |
T |
|
| Q |
220 |
tatgaattt |
228 |
Q |
| |
|
||||||||| |
|
|
| T |
32929497 |
tatgaattt |
32929489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University