View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10992_low_35 (Length: 223)
Name: NF10992_low_35
Description: NF10992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10992_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 37629602 - 37629395
Alignment:
| Q |
1 |
tctacccagttaccatctttgagaagctgaaggccactgaccatgtcagctgggaaaagaaggatgattccaccggcatcggtgtgtgcacggagaccct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37629602 |
tctacccagttaccatctttgagaagctgaaggccactgaccttgtcatcttggaaaagaaggatgattccaccggcatcggtgtgtgcacggagaccct |
37629503 |
T |
 |
| Q |
101 |
ttacaaggtctggttttgggcatggagggtagtttgcaaccttggttccaaaagttggtccctttgatccatacaaagccttttttaggtaccccttttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37629502 |
ttacaaggtctggttttgggcatggagggtagtttgcaaccttggttccaaaagttggtccctttgatccatacaaagccttttttaggtaccccttttc |
37629403 |
T |
 |
| Q |
201 |
tagtccaa |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
37629402 |
tagtccaa |
37629395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 13 - 208
Target Start/End: Original strand, 36871957 - 36872152
Alignment:
| Q |
13 |
ccatctttgagaagctgaaggccactgaccatgtcagctgggaaaagaaggatgattccaccggcatcggtgtgtgcacggagaccctttacaaggtctg |
112 |
Q |
| |
|
||||||||||| | || |||||||||||| | ||| | |||| |||||||||||||| |||||||||||||| ||||| |||||||| || || |||| |
|
|
| T |
36871957 |
ccatctttgagcaattgtaggccactgaccttatcatcctggaagagaaggatgattcctccggcatcggtgtgagcacgaagacccttcaccagctctg |
36872056 |
T |
 |
| Q |
113 |
gttttgggcatggagggtagtttgcaaccttggttccaaaagttggtccctttgatccatacaaagccttttttaggtaccccttttctagtccaa |
208 |
Q |
| |
|
| ||||||||| |||||||||| || || ||||| |||||||||||||| |||||||||| || |||||||| ||||| || || |||||||||| |
|
|
| T |
36872057 |
gatttgggcattgagggtagttggctactttggtgccaaaagttggtcctcttgatccataaaatgcctttttaaggtaacctttctctagtccaa |
36872152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 14 - 89
Target Start/End: Complemental strand, 8927045 - 8926970
Alignment:
| Q |
14 |
catctttgagaagctgaaggccactgaccatgtcagctgggaaaagaaggatgattccaccggcatcggtgtgtgc |
89 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||| || |||| ||||||||||| ||||| ||||| |||||||| |
|
|
| T |
8927045 |
catctttgagaagctgaagtccactgactttgtcatcttggaagagaaggatgatgccaccagcatctgtgtgtgc |
8926970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University