View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10994_high_38 (Length: 309)
Name: NF10994_high_38
Description: NF10994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10994_high_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 41770660 - 41770950
Alignment:
| Q |
1 |
aaaatgctgattatgctgctgagaaagccagagaaacgaaggacacaactgcaaataaagccggggaatacacaaactatgctgcagagaaagcgaggga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41770660 |
aaaatgctgattatgctgctgagaaagccagagaaacgaaggacacaactgcaaataaagccggggaatacacaaactatgctgcagagaaagcgaggga |
41770759 |
T |
 |
| Q |
101 |
ggcaaaagatactactgcgaataaagcaggggagtatacaaactatgcggcagagaaggcgaaggaagcgaaggatgcaacggtgaacaaagctggggag |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41770760 |
ggcaaaagataccactgcgaataaagcaggggagtatacaaactatgctgcagagaaggcgaaggaagcgaaggatgcaacggtgaacaaagctggggag |
41770859 |
T |
 |
| Q |
201 |
tatacgaactatgctgctgataaggcgaagcaggcaaaggatgcaacggtgcagaaggctggagaagctaaagatgctacagtgaacaaag |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41770860 |
tatacgaactatgctgctgataaggcgaagcaggcaaaggatgcaacggtgcagaaggctggagaagctaaagatgctacagtgaacaaag |
41770950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University