View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10994_high_49 (Length: 247)
Name: NF10994_high_49
Description: NF10994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10994_high_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 12 - 229
Target Start/End: Original strand, 14019395 - 14019612
Alignment:
| Q |
12 |
gaaggagagaactgacataacagagattctagggatcctaatagattctctaccccatgtctctcaaaacgccattgatggtagtagttggaaagctgca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14019395 |
gaaggagagaactgacataacagagattctagggatcctaatagattctctaccccatgtctctcaaaacgccattgatggtagtagttggaaagctgca |
14019494 |
T |
 |
| Q |
112 |
aaataaaagtcatgtccctattgttctattttacatctattttcatatagcttggtttttaacttatagaagagtagggttggtcaaaatgggaaagata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14019495 |
aaataaaagtcatgtccctattgttctattttacatctattttcatatagcttggtttttaacttatagaagagtagggttggtcaaaatgggaaagata |
14019594 |
T |
 |
| Q |
212 |
attattttcaaagtgaat |
229 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14019595 |
attattttcaaagtgaat |
14019612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University