View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10994_high_51 (Length: 244)
Name: NF10994_high_51
Description: NF10994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10994_high_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 16 - 78
Target Start/End: Original strand, 24383786 - 24383848
Alignment:
| Q |
16 |
gagcagagatgcaaggatttttagtttgggtgataatatatggagaagtgttccaagttttcc |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
24383786 |
gagcagagatgcaaggatttttagtttgggtgataatatttggaaaagtattccaagttttcc |
24383848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 78
Target Start/End: Original strand, 24391081 - 24391126
Alignment:
| Q |
33 |
tttttagtttgggtgataatatatggagaagtgttccaagttttcc |
78 |
Q |
| |
|
|||||||||||||||||||||| ||||||| | ||| ||||||||| |
|
|
| T |
24391081 |
tttttagtttgggtgataatatttggagaaatattcaaagttttcc |
24391126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 81
Target Start/End: Original strand, 24384862 - 24384910
Alignment:
| Q |
33 |
tttttagtttgggtgataatatatggagaagtgttccaagttttcctga |
81 |
Q |
| |
|
||||||||||||| ||| |||| ||||||||| ||| |||||||||||| |
|
|
| T |
24384862 |
tttttagtttgggagatgatatttggagaagtattcaaagttttcctga |
24384910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 142 - 221
Target Start/End: Complemental strand, 24950411 - 24950332
Alignment:
| Q |
142 |
aactattaactggttggtcattcgaaaggatattacatatgagtgtaataactatacccttgagaattttgcgatcatct |
221 |
Q |
| |
|
|||| |||| ||||||||||||||||| |||||||||||||| || ||||| |||| ||||||||||||||||||||| |
|
|
| T |
24950411 |
aactcttaattggttggtcattcgaaatgatattacatatgattggaataatcatactgttgagaattttgcgatcatct |
24950332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University