View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10994_low_31 (Length: 350)
Name: NF10994_low_31
Description: NF10994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10994_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 148 - 335
Target Start/End: Complemental strand, 49732765 - 49732582
Alignment:
| Q |
148 |
ataaagacatggttcatctttgaataaccttaattttgacttgagtaataagcaaccagccaagtgagaagaaacaaataaatacacatccccgaaccta |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49732765 |
ataaagacatggttcatctttgaataaccttaattttgacttgagtaataagcaaccagccaagtgagaagaaacaaataaatacacgtccccgaaccta |
49732666 |
T |
 |
| Q |
248 |
atctgattttcagggtcattgcttgtttgtgtcaggtcaccctattaaacaacgccgcaaaagactatacaacgacacatcctttcat |
335 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49732665 |
atctgattttcagggtcattgc----ttgtgtcaggtcaccctattaaacaacgccgcaaaagactatacaacgacacatcctttcat |
49732582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University