View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10994_low_36 (Length: 322)
Name: NF10994_low_36
Description: NF10994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10994_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 20 - 304
Target Start/End: Original strand, 7215807 - 7216091
Alignment:
| Q |
20 |
tatggtaccatggagcaagcatcatctggagattcattgtctgcttgctcaagtgaagcatgtaataaagttatggtacaaccaaccttcatatctagta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7215807 |
tatggtaccatggagcaagcatcatctggagattcattgtctgcttgctcaagtcaagcatgtaataaagttatggtacaaccaaccttcatatctagta |
7215906 |
T |
 |
| Q |
120 |
ctattacaacaccttaggcaatcatctcaacaaaactattgatttcatatgatattttttatacaactagacatatagtgtgtttggaattgtggtcaag |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7215907 |
ctattacaacaccttaggcaatcatctcaacaaaactattgatttcatatgatattttttatacaactagacatatagtgtgtttggtattgtggtcaag |
7216006 |
T |
 |
| Q |
220 |
ttacttcagacacatcaccattctcacatcaaaaacaactttaagatgcgagaaaaacgattagaaggtgaatcgaaacatagtt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7216007 |
ttacttcagacacatcaccattctcacatcaaaaacaactttgggatgcgagaaaaacgattagaaggtgaattgaaacatagtt |
7216091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University