View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10994_low_37 (Length: 322)
Name: NF10994_low_37
Description: NF10994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10994_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 19 - 317
Target Start/End: Complemental strand, 42968600 - 42968297
Alignment:
| Q |
19 |
ctaaattgggtattacctttacttttgccacatggaattgggatttggagggaactttatacaagaaccaagaaatggtaaaaataaatcatacacaaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42968600 |
ctaaattgggtattacctttacttttgccacatggaattgggatttggagggaactttatacaagaaccaagaaatggtaaaaataaatcatacacaaga |
42968501 |
T |
 |
| Q |
119 |
tgctcaatatgactgactgttatgtgcttttttcaacagttggagatggttgcatgacagaaaagaacagctttattagcagatatgctcaatcatccat |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42968500 |
tgctcaatatgactgattgttatgtgcttttttcaacagttggagatggttgcatgacaggaaagaacagctttattagcagatatgctcaaccatccat |
42968401 |
T |
 |
| Q |
219 |
gcttgggttgggtgggtgctccatggattgt-----gacaattcactagttccacagtgtatggtattggacataaaactgaatgtctcaaggcctttgc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42968400 |
gcttgggttgggtgggtgctccatggattgtgacatgacaattcactagttccacagtgtatggtattggacataaaactgaatgtctcaaggcctttgt |
42968301 |
T |
 |
| Q |
314 |
ttct |
317 |
Q |
| |
|
|||| |
|
|
| T |
42968300 |
ttct |
42968297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University