View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10994_low_38 (Length: 310)
Name: NF10994_low_38
Description: NF10994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10994_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 297
Target Start/End: Original strand, 49329276 - 49329568
Alignment:
| Q |
18 |
tatgtatgtgcactaatagttgtttctatacgagacaaatcgttaacaacacactttctagtactttctctgtaacattttttatgttattggttgaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49329276 |
tatgtatgtgcactaatagttgtttctatacgaggcaaatcgttaacaacacactttctaatactttctctgtaacattttttatgttattggttgaaat |
49329375 |
T |
|
| Q |
118 |
tcatgagttacattcacattagaaattacatgacacgtctaaattaataaaacatgcatgaatttcaaccaat-nnnnnnngttttgcaaagaaatgaaa |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49329376 |
tcatgagttacattcacattgaaaattacatgacacgtctaaattaataaaacatgcatgaatttcaaccaataaaacaaagttttgcaaagaaatgaaa |
49329475 |
T |
|
| Q |
217 |
gagtgtgttgttaacacgtc------------cattgtcattgtcattgttttatgtagtttgttaatgtgtagtctgttcaaacattcatct |
297 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49329476 |
gagtgtgttgttaacacgtccattgtcattgtcattgtcattgtcattgttttatgtagtttgttaatgtgtagtctgtccaaacattcatct |
49329568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University