View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10994_low_41 (Length: 293)
Name: NF10994_low_41
Description: NF10994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10994_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 15 - 282
Target Start/End: Complemental strand, 38733928 - 38733661
Alignment:
| Q |
15 |
tcaatatgcaaattgagattacaagcccccctaaccgtggagctggcaagccagtcattggtgaagtgaatctcatcatctcataatttgtctgcggttt |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38733928 |
tcaacatgcaaattgagattacaagcccccctaaccgtggagctggcaagccagtcattggtgaagtgaatctcatcatctcataatttgtctgcggttt |
38733829 |
T |
|
| Q |
115 |
tgcaccgtcaaataattctctcagcttcaaattcaaccaattagggcatgacactcctttttaggactatgtaagctacgcgcttcatgaatgttatcca |
214 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38733828 |
tgcaccatcaaataattctctcagcttcaaattcaaccaattagggcatggcactcctttttaggactatgcaagctacgcgcttcatgaatgttatcca |
38733729 |
T |
|
| Q |
215 |
atcattttcctccgtgttttcgacgcgtctagggcattgcattctccccaaacaatacccaccttctt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38733728 |
atcattttcctccgtgttttcgacgcgtctagggcattgcattctccccaaacaatacccaccttctt |
38733661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University