View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10994_low_46 (Length: 266)
Name: NF10994_low_46
Description: NF10994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10994_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 43375384 - 43375129
Alignment:
| Q |
1 |
acaatcaggggaccaattcctgcagtgaagtatgacgaggtaagaaagcgcaagatttggtttaatagcatggttgctgcttacactggttggaaagatg |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43375384 |
acaatcatgggaccaattcctgcagtgaagtatgatgaggtaagaaagcgcaagatttggtttaatagcatggttgctgcttacactggttggaaagatg |
43375285 |
T |
|
| Q |
101 |
agagaaacgatcctgttaaggcagtgacatttggggatggcagccctttacctgctgatgtagtgtacaattgtcttaacatacttgaggaggaatctgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43375284 |
agagaaacgatcctgttaaggcagtgacatttggggatggcagccctttacctgctgatgtagtgtacgattgtcttaacatacttgaggaggaatctgt |
43375185 |
T |
|
| Q |
201 |
tgctattccttggcgtaaaggcgatgttatgttgctcgataattgggctgttcttc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43375184 |
tgctattccttggcgtaaaggcgatgttatgttgctcgataattgggctgttcttc |
43375129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University