View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10994_low_48 (Length: 251)
Name: NF10994_low_48
Description: NF10994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10994_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 86 - 226
Target Start/End: Original strand, 44622600 - 44622741
Alignment:
| Q |
86 |
ttgttatattcacgaaatatccggattctagatttggtttgaaaatatataatgcgagtaaactatattttcaaatcaaataaaac-gtttcagtaaaat |
184 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44622600 |
ttgttatattcacgaaatatccggattgtagatttggtttgaaaatatataatgtgagtaaactatattttcaaatcaaataaaactgtttcagtaaaat |
44622699 |
T |
|
| Q |
185 |
tagcttggtttttaaatttgatataaatttgatttgattcgc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44622700 |
tagcttggtttttaaatttgatataaatttgatttgattcgc |
44622741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University