View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10994_low_49 (Length: 251)
Name: NF10994_low_49
Description: NF10994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10994_low_49 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 23888565 - 23888801
Alignment:
| Q |
1 |
tttctactgaaaacaacatttcaattgtgttcaattggttggagagttctctttatgtagcctcagaaaactaatcagttattcctcacattgccactgc |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23888565 |
tttctactgaatacaacatttcaattgtgttcaattggttggaaagttctctttatgtagcctcagaaaactaatcaattattcctcacattgccactgc |
23888664 |
T |
|
| Q |
101 |
tgatgtgtatgtattttcacagttaaggtgcttcaaggactgtggaggaatgatttggtgtcactaaaaggtgcatgtccaaattggggtgaagaggtta |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
23888665 |
ttatgtgtatgtattttcacagttaaggtgcttcaaggactgtggaggaatgatttggtgtcactaaaaggtgcatgtccaaattgtggagaagaggtta |
23888764 |
T |
|
| Q |
201 |
gttcactttgcaattgaacattcatataattaatgtt |
237 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
23888765 |
gttcactttgcaagtgaacattcatataattcatgtt |
23888801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 131 - 202
Target Start/End: Original strand, 41518536 - 41518607
Alignment:
| Q |
131 |
cttcaaggactgtggaggaatgatttggtgtcactaaaaggtgcatgtccaaattggggtgaagaggttagt |
202 |
Q |
| |
|
|||||||| ||||||||||||| |||| ||||||| ||| ||||||||||||| || |||||||||||| |
|
|
| T |
41518536 |
cttcaaggcttgtggaggaatgacttggcagcactaaagggttcatgtccaaattgtggagaagaggttagt |
41518607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University