View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10994_low_51 (Length: 245)
Name: NF10994_low_51
Description: NF10994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10994_low_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 2 - 228
Target Start/End: Complemental strand, 8161621 - 8161395
Alignment:
| Q |
2 |
aactagtaaatacatcctcaattttcgaacaaaatttttaatactcaacttgcaattcttacaaggataaaattacaaatcctatcatacaatttttgca |
101 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8161621 |
aactagtaaatacatccacaatttttgaacaaaatttttaatactcaacttgcaattcttacaaggataaaattacaaatcctatcatacaatttt-gca |
8161523 |
T |
|
| Q |
102 |
gaaacaaaatcggaaaccccatcaactactaatgtaatttttacagacttgcaaactctctcaactaaaaattttgtggggaaaaattgtaaattcactc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8161522 |
gaaacaaaatcggaaaccccatcaactactaatgtaatttttacagacttgcaaactctctcaactaaaaattttgtggggaaaaattgaaaattcactc |
8161423 |
T |
|
| Q |
202 |
-tgacaaacaactaagcaagcgtctagt |
228 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8161422 |
atgacaaacaactaagcaagcgtctagt |
8161395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University