View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10994_low_54 (Length: 237)
Name: NF10994_low_54
Description: NF10994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10994_low_54 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 35 - 237
Target Start/End: Complemental strand, 42239562 - 42239353
Alignment:
| Q |
35 |
atgtttggtacatatatgttttagtgcgaacaaagtagttttggtaggatgaagaaggtggtgtaaac--------ttccttcattccaaactctgattg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
42239562 |
atgtttggtacatatatgttttagtgcgaacaaagtagttttggtaggatgaagaaggtggtgtaaacaatttagattccttcaatccaaactctgattg |
42239463 |
T |
|
| Q |
127 |
ttcctacaaattagaaatgannnnnnnagggtttgggtgggccacggcccatccaagccaatgaatggctccgccactgtgcactgccatcatgtgtgca |
226 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42239462 |
ttccaacaaattagaaatgatttttt-agggtttgggtgggccacggcccatccaagccaatgaatggctccgccactgtgcactgccatcatgtgtgca |
42239364 |
T |
|
| Q |
227 |
aatatttacac |
237 |
Q |
| |
|
||||||||||| |
|
|
| T |
42239363 |
aatatttacac |
42239353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University