View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10994_low_59 (Length: 211)
Name: NF10994_low_59
Description: NF10994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10994_low_59 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 37845258 - 37845078
Alignment:
| Q |
18 |
gtcatgagctattgttttcatgattatgcgtttatgcttctaagtcnnnnnnnnttgcagctaaactagtttgtcaattggcaaggttttccaacgtgct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37845258 |
gtcatgagctattgttttcatgattatgcatttatgcttctaagtcaaaaaaaattgcagctaaactagtttgtcaattggcaaggttttccaacgtgct |
37845159 |
T |
|
| Q |
118 |
taccaaaggagcaggtcctctcacaactcttccttggtcattgtactgagatccatggcaggggcagatgaacttcttctc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37845158 |
taccaaaggagcaggtcctctcacaactcttccttggtcattgtactgagatccatggcaggggcagatgaacttcttctc |
37845078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University