View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10996_low_15 (Length: 245)
Name: NF10996_low_15
Description: NF10996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10996_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 25008694 - 25008922
Alignment:
| Q |
17 |
aaaaaagaaaatctagcggaacgcgttggttgataattccaactgtcatggataacaacttgtcatagacagacacaatcaaagaacacaacctaacaaa |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25008694 |
aaaaaagaaaatctagtggaacgcgttggttgataattccaactgtcatggataacaacttgtcatagacagacacaatcaaagaacacaacctaacaaa |
25008793 |
T |
|
| Q |
117 |
acaacatcat--------aacacatttatatatgttgtgttc---ttattatcgttaaggttttggtttcacatgaacaaacaaacaaacacagattcca |
205 |
Q |
| |
|
| |||||||| |||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25008794 |
ataacatcataacacccaaacacatttatatatgttctgttcttattattattgttaaggttttggtttcacatgaacaaacaaacaaacatagattcca |
25008893 |
T |
|
| Q |
206 |
ttgatccattcatagtacacatctttgtc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25008894 |
ttgatccattcatagtacacatctttgtc |
25008922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University