View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10999_low_3 (Length: 409)
Name: NF10999_low_3
Description: NF10999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10999_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 1 - 397
Target Start/End: Original strand, 39474449 - 39474845
Alignment:
| Q |
1 |
taaaattatataaattacttcattgcagttcgctagcatttatgggattcgctggatccttgacacctagaataggagctctaaaaagtcttacaactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39474449 |
taaaattatataaattacttcattgcagttcgctagcatttatgggattcgctggatccttgacacctagaataggagctctaaaaagtcttacaactct |
39474548 |
T |
 |
| Q |
101 |
gtaagtatatatcaagtacccacagtgtagttcctagtcttgtcattctcagtgttttggattatagtattgttatgatgtgattggatgaaaccatatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39474549 |
gtaagtatatatcaagtacccacagtgtagttcctagtcttgtcattctcagtattttggattatagtattgttatgatgcgattggatgaaaccatatg |
39474648 |
T |
 |
| Q |
201 |
gatacttttgattgttatttttatttgcttatttaggatgtacatgttttctgtgaaatatattatcttctatgcatctgatgaactagaagagtactag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
39474649 |
gatacttttgattgttatttttatttgcttatttaggatgtacatgttttctgtgaaatatattatcttctatgcgtctgatgaactagaagagtactgg |
39474748 |
T |
 |
| Q |
301 |
ggttcgtgtacataagatttggttacttctgaaaaatcatccaattccctttggtgaattttgtgattttaagtcttctcttatttctcacaggttc |
397 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
39474749 |
ggttcgtgtacataaaatttggttacttctgaaaaatcatccaattccctttggtgaattttatgattttaactcttctcttatttgtcacaagttc |
39474845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University