View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1099_low_12 (Length: 299)
Name: NF1099_low_12
Description: NF1099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1099_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 2e-43; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 73 - 236
Target Start/End: Original strand, 44767235 - 44767399
Alignment:
| Q |
73 |
agattcatggttaagtttgggagatcacaannnnnnnnngatctaccccgaggttttctttgacacttgttttgtatgcccttctcctcgataatgttaa |
172 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44767235 |
agattcatggctaagtttgggagaccacaatttttttttggtctaccccgaggttttctttgacatttgttttgtatgcccttctcctcgataatgttaa |
44767334 |
T |
|
| Q |
173 |
gaggtccttcagtgttggatacatctagtcgtagttgtgca-aatgtgatggtgttttaatcctt |
236 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||| || ||||||||||||||| ||||||| |
|
|
| T |
44767335 |
gaggtccttcgctgttggatacatctggttgtagttgtacagaatgtgatggtgtttcaatcctt |
44767399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 73 - 236
Target Start/End: Original strand, 44766703 - 44766867
Alignment:
| Q |
73 |
agattcatggttaagtttgggagatcacaannnnnnnnngatctaccccgaggttttctttgacacttgttttgtatgcccttctcctcgataatgttaa |
172 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44766703 |
agattcatggctaagtttgggagaccacaatttttttttggtctaccccgaggttttctttgacatttgttttgtatgcccttctcctcgataatgttaa |
44766802 |
T |
|
| Q |
173 |
gaggtccttcagtgttggatacatctagtcgtagttgtgca-aatgtgatggtgttttaatcctt |
236 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| || |||||||||||| ||||||| |
|
|
| T |
44766803 |
gaggtccttcggtgttggatacatctgttcgctcttgtgcagaaggtgatggtgtttcaatcctt |
44766867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 118 - 236
Target Start/End: Original strand, 44766216 - 44766335
Alignment:
| Q |
118 |
ccccgaggttttctttgacacttgttttgtatgcccttctcctcgataatgttaagaggtccttcagtgttggatacatctagtcgtagttgtgca-aat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| ||| ||||||| || |
|
|
| T |
44766216 |
ccccgaggttttctttgacacttgttttgtatgcccttcttctcgataatgttaagaggtccttcggtgttggatacatctgttcgctcttgtgcagaag |
44766315 |
T |
|
| Q |
217 |
gtgatggtgttttaatcctt |
236 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
44766316 |
gtgatggtgtttcaatcctt |
44766335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University