View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1099_low_14 (Length: 293)
Name: NF1099_low_14
Description: NF1099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1099_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 30 - 283
Target Start/End: Original strand, 6994462 - 6994727
Alignment:
| Q |
30 |
atatgcagtttaagtagttatacttctagatcaataactaactctagtaacaattgtatatgtatatagaatatatgtgtgtgtcctatctcatttctaa |
129 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||||||||| |
|
|
| T |
6994462 |
atatgaagtttaagtagttatacttctagatcaataactaactctagtaacaattgtatatggatatagtatatatgtgtcagtcctatctcatttctaa |
6994561 |
T |
|
| Q |
130 |
aactagattggtgaataatgaagtgt------------ttcttcttccatatgaattctttttgttgtaagcttttttcttcaatcatgtttgagattaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6994562 |
aactagattggtgaataatgaagtgtctattcatgagcttcttcttccgtatgaattctttttgttgtaagctttcttcttcaatcatgtttgagattaa |
6994661 |
T |
|
| Q |
218 |
cctttcacaactacttgagtcaaatcactttattaataccatttgttatatgtgtgccgttctgtg |
283 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||| |||| |
|
|
| T |
6994662 |
cctttcacaactacttgagttaaatcactttattaatatcattttttatatgtgtgccgttttgtg |
6994727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 113 - 153
Target Start/End: Original strand, 33190223 - 33190263
Alignment:
| Q |
113 |
tcctatctcatttctaaaactagattggtgaataatgaagt |
153 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
33190223 |
tcctatctcacttgtaaaactagattggtgaataatgaagt |
33190263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 67
Target Start/End: Complemental strand, 23913296 - 23913260
Alignment:
| Q |
31 |
tatgcagtttaagtagttatacttctagatcaataac |
67 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23913296 |
tatgcagtttaggtagttatacttctagatcaataac |
23913260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University