View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1099_low_16 (Length: 291)
Name: NF1099_low_16
Description: NF1099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1099_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 11 - 263
Target Start/End: Complemental strand, 44675042 - 44674790
Alignment:
| Q |
11 |
cacagaccaacttggttccattaatctttgtattggcatagccactcactaactgaaaattgtttttgttgcggctaataatgctaatatcgtcgatgat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44675042 |
cacagaccaacttggttccattaatctttgtattggcatagccactcactaactgaaaattgtttttgttgcggctaataatgctaatatcgtcgatgat |
44674943 |
T |
 |
| Q |
111 |
catgttcttaatgctgcttgtgggaatttgagatattgacactgcagcattagctggtggaattatggtggtggatgtcgttgagtcgttaagtggccga |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44674942 |
catgttcttaatgttgcttgtgggaatttgagatattgacactgcagcattagctggtggaattatggtggtggatgtcgttgagtcgttaagtgaccga |
44674843 |
T |
 |
| Q |
211 |
tgagtttgagggtcgactccacgactgtagagttttcgcttgatgtgagtgtt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44674842 |
tgagtttgagggtcgactccacgactgtagagttttcgcttgatgtgagtgtt |
44674790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University