View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1099_low_17 (Length: 289)
Name: NF1099_low_17
Description: NF1099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1099_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 39 - 229
Target Start/End: Original strand, 40284845 - 40285055
Alignment:
| Q |
39 |
acgaacattacccatgatcttgacctaaaaacgcagatgacatgcttatctta--------------------aatataaaacattttctgtcaccatgc |
118 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40284845 |
acgaacattacctatgatcttgacctaaaaacgcagatgacatgcttatcttatcttatcttagagtccaataaatataaaacattttctgtcaccatgc |
40284944 |
T |
 |
| Q |
119 |
ttgcaacaaatagcaagttaaccaagttacaatttaaaaaatattcaaactccttcctaaagaatataggcataagcacaaaaaatggccaaaaataaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40284945 |
ttgcaacaaatagcaagttaaccaagttacaatttaaaaaatattcaatctccttcctaaagaatataggcataagcacaaaaaatgtccaaaaataaat |
40285044 |
T |
 |
| Q |
219 |
ttactgatgat |
229 |
Q |
| |
|
|| |||||||| |
|
|
| T |
40285045 |
ttgctgatgat |
40285055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University