View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1099_low_26 (Length: 251)
Name: NF1099_low_26
Description: NF1099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1099_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 17271031 - 17270796
Alignment:
| Q |
1 |
ctcattctgcccaaactatgatgctcttggtctctttgcttcttcgatctcaaga-------------attgtggtgatggagagaagtgtgagctacat |
87 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17271031 |
ctcattctgcccaaactatgatgctcttagtctctttgcttcttcgatctcaagatattggggtaagaattgtggtgatggagagaagtgtgagctacat |
17270932 |
T |
 |
| Q |
88 |
gatgaaagggcacaaattaccaaggtattggcgcgcctcaatttgaagacatggttaacatgaaattactaaccatgtcatttgattgagccgcgtcaat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17270931 |
gatgaaagggcacaaattaccaaggtattggcgcgcctcaatttgaagacatggttaacatgaaattactaaccatgtcatttgattgagccgcgtcaat |
17270832 |
T |
 |
| Q |
188 |
atctcgctcatgatccacttcttttcatccccatgt |
223 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
17270831 |
atctcgctcatgatctacttcttttcatctccatgt |
17270796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 141
Target Start/End: Original strand, 37124713 - 37124746
Alignment:
| Q |
108 |
caaggtattggcgcgcctcaatttgaagacatgg |
141 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
37124713 |
caaggtattggcgcgcctcaatttgaatacatgg |
37124746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University