View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1099_low_31 (Length: 218)
Name: NF1099_low_31
Description: NF1099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1099_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 25217361 - 25217495
Alignment:
| Q |
1 |
ttggataaggtaagatagatgttagaagtcggttataaatcggttatattagttagaaatcggttataatgttttgttttgttataggatggtcgagtaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25217361 |
ttggataaggtaagatatatgttagaagtcggttataaatcg-ttatattagttagaaatcggttataatgttttgttttgttataggatggtcgagtaa |
25217459 |
T |
 |
| Q |
101 |
gttttgaggaatttaaggcaatgatgaagacaggag |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25217460 |
gttttgaggaatttaaggcaatgatgaagacaggag |
25217495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 74 - 133
Target Start/End: Complemental strand, 1969696 - 1969637
Alignment:
| Q |
74 |
ttgttttgttataggatggtcgagtaagttttgaggaatttaaggcaatgatgaagacag |
133 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1969696 |
ttgttttgttaaagaatggtcgagtaagttttgaggaatttaaggcaatgatgaagacag |
1969637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University