View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11000_low_15 (Length: 220)
Name: NF11000_low_15
Description: NF11000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11000_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 12 - 206
Target Start/End: Original strand, 32024800 - 32024990
Alignment:
| Q |
12 |
gtgagaagaagacaaaccaaacatacacttagtttgttcgttgacctttgataatctttaataatgaggaaaatagatatgtgagtctcttttgggttga |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32024800 |
gtgaaaagaagacaaaccaaacatacacttagtttgtt----gacctttgataatctttaataatgaggaaaatagatatgtgagtctcttttgggttga |
32024895 |
T |
|
| Q |
112 |
actgtgtgattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgttttctatttaatttgttgatttgggtttatgtttgatgt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32024896 |
actgtgtgattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgttttctatttaatttgttgatttgggtttatgtttgatgt |
32024990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 88 - 173
Target Start/End: Original strand, 32026304 - 32026389
Alignment:
| Q |
88 |
atatgtgagtctcttttgggttgaactgtgtgattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgttttcta |
173 |
Q |
| |
|
|||||||| |||||||||| || || ||| ||| |||||| |||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
32026304 |
atatgtgaatctcttttggatttaagtgtatgagtaaatgaaattttgatgatctgtgtgtttgacttcattttggttgttttcta |
32026389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University