View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11001_high_1 (Length: 414)
Name: NF11001_high_1
Description: NF11001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11001_high_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 306
Target Start/End: Complemental strand, 33757270 - 33756982
Alignment:
| Q |
18 |
ctgtgacggtaacggaaatgactgtgacggtgacggtgattgtgattgagaagaatgtttattaatcatgaagagagtgaaagcattaaaagtggttcga |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33757270 |
ctgtgacggtaatggaaatgactgtgactgtgacggtgattgtgattgagaagaatgtttattaatcatgaagagagtgaaagcattaaaagtggttcga |
33757171 |
T |
|
| Q |
118 |
attggcgtattggaaataacattgagaatttgaagagcttgattttctgccatcgttgcgaggagtcgtatcgttgaaggatcgagtggtggctgtgatt |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33757170 |
attggtgtattggaaataacattgagaatttgaagagcttgattttctgccatcgttgcgaggagtcgtatcgttgaaggatcgagtggtggttgtgatt |
33757071 |
T |
|
| Q |
218 |
gtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctccgtcgccataactaactttcacggc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33757070 |
gtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctccgtcgccataacaaactttcacggc |
33756982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University