View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11001_high_12 (Length: 309)
Name: NF11001_high_12
Description: NF11001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11001_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 7e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 11 - 210
Target Start/End: Complemental strand, 16895253 - 16895055
Alignment:
| Q |
11 |
cataggagggatgattttgaggtagcaagtgctgataagaactttgagagcacacccaaggagcaagttagtagagtaggctcttaggatgctcatctca |
110 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||| ||||| |||||||||||||||||||| ||| ||||| |
|
|
| T |
16895253 |
cataggagggatggttttgaggtagcaagtgctgataagatctttgagagcacatccaaggaacaagtgagtagagtaggctcttaggaggcttgtctca |
16895154 |
T |
|
| Q |
111 |
gtctctaccatcatcatcatcatgtacatatacttttccttttggggaagagaaaacattttagaccc--aatgtgtatactgcatgattcaactgggtt |
208 |
Q |
| |
|
| | | || | ||||| || ||| ||||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||| |
|
|
| T |
16895153 |
gagtgtgccgtgatcatgtacagatac---tacttttccctttggggaagagaaaacattttagacccataatatgtatactgcatgattcaattgggtt |
16895057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 226 - 309
Target Start/End: Complemental strand, 3002011 - 3001927
Alignment:
| Q |
226 |
gataactctgtaaaaacaagtcaat-gtcataaagtttggacaagaaactgcagcaattaccgtttatgcaacctttaaatagta |
309 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3002011 |
gataactatgtaaaaacaagtcaaaagtcataaagtttggacaagaaactgcagcaattaccatttatgcaacctttaaatagta |
3001927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 11 - 89
Target Start/End: Complemental strand, 32707194 - 32707116
Alignment:
| Q |
11 |
cataggagggatgattttgaggtagcaagtgctgataagaactttgagagcacacccaaggagcaagttagtagagtag |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32707194 |
cataggagggatgattttgaggtagcaagtgctgataagaactttgagagcacacccaaggagcaagttagtagagtag |
32707116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University