View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11001_high_8 (Length: 348)
Name: NF11001_high_8
Description: NF11001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11001_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 27 - 335
Target Start/End: Complemental strand, 29958817 - 29958509
Alignment:
| Q |
27 |
tcagcaaaagatgatgtcctttctggcaaaggccatgaatagtccgggctttatggctcaattttcacagcagcagaatgaaagtaatagacatgttacc |
126 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29958817 |
tcagcaacagatgatgtcctttctggcaaaggccatgaatagtccgggctttatggctcaattttcacagcagcagaatgaaagtaatagacatgttacc |
29958718 |
T |
|
| Q |
127 |
gcaggtaaaaagaggcggctccaggggcaggaagaagatagtttagacaccaagaatccccataatcctcttgatggacgtgttgttaagtaccagcctt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29958717 |
gcaggtaaaaagaggcggctccaggggcaggaagaagatagtttagccaccaagaatccccataatcctcttgatgggcgtgttgttaagtaccagcctt |
29958618 |
T |
|
| Q |
227 |
cgattaatgaggctgcaaaaacattatttaaccagatgttgcaaatgaacagttctgcaagggtggattcctccatcaagaaccttgatgcattccttat |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29958617 |
cgattaatgaggctgcaaaaacattatttaaccagatgttgcaaatgaacagttctgcaagggtggattcctccatcaagaaccttgatgcattccttat |
29958518 |
T |
|
| Q |
327 |
tgatgatgt |
335 |
Q |
| |
|
||||||||| |
|
|
| T |
29958517 |
tgatgatgt |
29958509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University