View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11004_high_1 (Length: 463)
Name: NF11004_high_1
Description: NF11004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11004_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 15 - 445
Target Start/End: Complemental strand, 37028199 - 37027769
Alignment:
| Q |
15 |
gacaagcatagcagtaccaccaaaatcacaagtccccccaccaatcttagtgttctgccaatagctattgaatgcataagaagcatgtgccaacactgtg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37028199 |
gacaagcatagcagtaccaccaaaatcacaagtccccccaccaatcttagtgttctgccaatagctattaaatgcataagaagcatgtgccaacactgtg |
37028100 |
T |
 |
| Q |
115 |
ttgggctgaaagcatatcccattaggctgaactgatttacagtcagccccagacccacaggcatagtccatagccacttgaattataggatcaggaactg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37028099 |
ttgggctgaaagcatatcccattaggctgaactgatttacagtcagccccagacccacaggcataatccatagccacttgaattataggatcaggaactg |
37028000 |
T |
 |
| Q |
215 |
taggctttgccacacaccaaatagcatattgtggtggcttcttatgagttgaaggtggtggtggataaacaataggaggcaagtatacttgaggtgggcc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37027999 |
taggctttgccacacaccaaatagcatattgtggtggcttcttatgagttgaaggtggtggtggataaacaataggtggcaagtatacttgaggtgggcc |
37027900 |
T |
 |
| Q |
315 |
tataacacttttaggtgggcttggaacatgttttgattggcttggaggtggcggcggcgatattgtgacaacggttttaggacttggtggtggtctaaaa |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
37027899 |
tataacacttttaggtgggcttggaacatgttttgatgggcttggaggtggcggcggcgacattgtaacaatggttttaggacttggtggtggtctaaaa |
37027800 |
T |
 |
| Q |
415 |
acatcatgaggtgggtttggaacaggtgaat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37027799 |
acatcatgaggtgggtttggaacaggtgaat |
37027769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University