View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11004_low_3 (Length: 308)
Name: NF11004_low_3
Description: NF11004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11004_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 76 - 298
Target Start/End: Original strand, 13753299 - 13753520
Alignment:
| Q |
76 |
acaatggttttgagaaacacaacgcagtacctaacaggttattagtctttcaacaaactttatattatcggtacaaatagaccagtaaatatgatcagaa |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13753299 |
acaatggttttgagaaacacaacgcagtacctaacaggttattagtctttcaacaaactttatattatcagtacaaatagaccagtaaatatgatcagaa |
13753398 |
T |
|
| Q |
176 |
gttaattgaggagggggatgctttgaacatgatacactaaaatctgggaacaaagaaaattcgtcttatgatttttctgtaataaagattggaaatcatt |
275 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13753399 |
gttatttgagga-ggggatgctttgaacatgatacactaaaatctgggaacaaagaaaattcgtcttatgatttttctgtaataaagattggaaatcatt |
13753497 |
T |
|
| Q |
276 |
atggaatttgtatggtgcctttg |
298 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
13753498 |
atggaatttgtatcgtgcctttg |
13753520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 32 - 75
Target Start/End: Original strand, 13753175 - 13753218
Alignment:
| Q |
32 |
aaaatttgaaagattagtgattgtttagttctgtgtttcctata |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13753175 |
aaaatttgaaagattagtgattgtttagttatgtgtttcctata |
13753218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University