View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11006_high_30 (Length: 289)
Name: NF11006_high_30
Description: NF11006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11006_high_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 26777063 - 26777331
Alignment:
| Q |
1 |
cacaaactcctcaagctccatctgctggtaccagaactttaaatgatccaccagctccacgtgccggaatgtatgttgcaaccccgccttctggagttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
26777063 |
cacaaactcctcaagctccatctgctggtaccagaactttaaatgatccaccagttccacctgccggaatgtatgttgtgaccccgccttctggagtcgg |
26777162 |
T |
 |
| Q |
101 |
agcttatgctgctcataggatcgggcaacctataggaggacggaattgcactcccggatagatggcttatggtattggaccagtttcttggacaagtata |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26777163 |
agtttatgctgctcataggatcgggcaacctataggaggacggaattgcactcccggacagatggcttatggtattggaccagtttcttggacaag--ta |
26777260 |
T |
 |
| Q |
201 |
tgccaggggtaacaatgaacttgcgtcctatgacatttcccatgcaaaatacatatgctcacttatgaagt |
271 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26777261 |
tgccaggggtaccaatgaacttgggtcctatgacatttcccatgcaaaatacatatgctcacttatgaagt |
26777331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 271
Target Start/End: Complemental strand, 26553626 - 26553508
Alignment:
| Q |
151 |
ctcccggatagatggcttatggtattggaccagtttcttggacaagtatatgccaggggtaacaatgaacttgcgtcctatgacatttcccatgcaaaat |
250 |
Q |
| |
|
|||||||| | |||| ||||||| |||||||||||||| |||| || ||||||||||||| |||||||| || |||||||||||| | |||||| | || |
|
|
| T |
26553626 |
ctcccggagacatggattatggtcttggaccagtttctgagaca-gt-tatgccaggggtaccaatgaacctgggtcctatgacatatgccatgctacat |
26553529 |
T |
 |
| Q |
251 |
acatatgctcacttatgaagt |
271 |
Q |
| |
|
||||||||||| | ||||||| |
|
|
| T |
26553528 |
acatatgctcaatcatgaagt |
26553508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 108 - 141
Target Start/End: Complemental strand, 26553699 - 26553666
Alignment:
| Q |
108 |
gctgctcataggatcgggcaacctataggaggac |
141 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
26553699 |
gctgctcctaggatcgggcaacctataggaggac |
26553666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University